Analogy and Homology

 

1.

         A.     Two species that possess a homologous trait are humans and the dolphin.  

         B.     The homologous trait that each species shares is the human arm and the dolphin fin.  Though               each one is used differently.  The dolphin fin contains bones, it curves back and pointed at the             tip.  The human arm also contains bone but has joints at the elbow, wrist and fingers.  The fin is           used to turn, stop, balance and help with body heat.  The human arm is used to hold, grab,                   push, pull, and many other things.  The reason for the differences in the dolphins fin and the               human arm is due to different functions in their respective environments. 

         C.     Dolphins and humans are both mammals and have a common ancestor, tetrapods which                      possessed this homologous trait.  It is known that tetrapods possessed this homologous trait                    through cladistic analysis.

                 

2.

A.     Two different species that possess the analogous trait are the duck billed platypus and the duck.

B.     The analogous trait that the duck billed platypus and the duck share is that they both lay eggs.  The duck billed platypus looks like a duck, has a bill like a duck and webbed feet, but is a mammal that lays eggs.  This is more commonly seen in birds.

C.     Although the duck and the platypus may look very similar and both lay eggs they do not share a common ancestor.  The platypus is a mammal and the duck is a bird that has wings and can fly.  In this case the traits are analogous.

Protein Synthesis Transcription and Translation

DNA molecule:

GCTATACCAAGTGACTGAACGGAACGGCAAGTTGACACATGTCTGAAGTGTAATCTGGT

Lamark’s Influence on Darwin

Jean-Baptiste Lamark was a French botanist.  His most noteworthy contribution to the science community is his theory of the inheritance of acquired characteristics.  Lamark suggested that species acquired certain characteristics as their environment changed.

http://www.scientificlib.com/en/Biology/Biographies/JeanBaptisteLamarck.html

                          “How does evolution work?

· If the environment changes, the traits that are helpful or adaptive to that environment will be different. Organisms with those new adaptive traits will have greater reproductive success than others and those new beneficial traits will spread, producing a change in the population. This is the process of natural selection, essentially the process of the natural environment selecting the organisms that will be most successful.”

The bullet point listed above was influenced by Lamark’s theory in a profound way.  Lamark’s idea opened the door to the fact that there was a significant link between organisms and their outside environment in the course of evolution. 

Darwin may have never developed his theory of natural selection if it were not for Jean-Baptiste Lamark.  Lamark was definitely a positive influence towards Darwin’s theory. Darwin was mindful of Lamark’s work throughout his college years.  Lamark’s theory gave Darwin a starting point and allowed him to build from there. 

The attitude of the church affected Darwin’s publication of his book On the Origin of Species in a huge way, so much so that Darwin delayed its publication.  Darwin’s book was very controversial, as society viewed the talk of evolution as atheism.  Darwin also did not want to disappoint his wife who was very religious.  The church was afraid that if ideas of evolution were accepted amongst society it would fall apart and the church would no longer exist.

Ciochon, Jurmain, Kilgore, and Trevathan, Wenda, Introduction to Physical Anthropology.  Belmont:  Wadsworth Cengage Learning, 2014.  Print.